Review

pb tac oks (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc pb tac oks
Pb Tac Oks, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcx+oks+2a/pCX-OKS-2A+(Plasmid+%2319771)/bio_rxiv__2025__02__21__639524-312-10-16
Average 93 stars, based on 18 article reviews

pb tac oks - by Bioz Stars, 2026-09

93/100 stars

Images

Transfection:

Article Title: A Highly Optimized Protocol for Reprogramming Cancer Cells to Pluripotency Using Nonviral Plasmid Vectors
Article Snippet: .. These included pCX-OKS-2A (encoding Oct-3/4, Sox2, and Klf4) and pCX-cMyc (encoding c-Myc) from Addgene (cat. no. 19771, 19772) for iPSC induction and pIRES2-EGFP from Clontech (cat. no. 6029-1) for the assessment of cell transfection efficiency. .. The other main components of the transfection reagents used were Opti-MEM I Reduced Serum Medium (Invitrogen, cat. no. 31985-062) and X-tremeGENE Transfection Reagent (Roche, cat. no. 06366511001).

Sequencing:

Article Title: Interactions between pluripotency factors specify cis -regulation in embryonic stem cells
Article Snippet: .. Klf4 sequence was taken from the pCX-OKS-2A plasmid, Klf2 was taken from the pMXs-ms-Klf2 plasmid, and Klf5 was taken from the pMXs-ms-Klf5 plasmid. pCX-OKS-2A (Addgene plasmid #19771), pMXs-ms-Klf2 (Addgene plasmid #50786), and pMXs-ms-Klf5 (Addgene plasmid #50787) were gifts from Shinya Yamanaka. .. The array ordered from Agilent consisted of 150-bp oligos with the following sequence: ACTACAAGGGCCCA[CRE]AAGCTTCT[FILL]CGTCTAGAC[BC]TGAGCTCTGCAACTCCTACG where [CRE] is the CRE comprised of concatenated building blocks of binding sites described below, [FILL] is a random filler sequence to bring the length of the sequence up to 150 bp (the filler is of variable length depending on the length of the CRE), and [BC] is a random 9-bp barcode.

Plasmid Preparation:

Article Title: Overcoming the Specific Toxicity of Large Plasmids Electrotransfer in Primary Cells In Vitro
Article Snippet: .. It was here used as a reference to compare with pCX-cMyc (6,131 bp; Addgene plasmid 19772), pcDNA3.3_eGFP (6,303 bp; Addgene plasmid 26822), pCX-OKS-2A (8,495 bp; Addgene plasmid 19771), pCXLE-eGFP (10,912 bp; Addgene plasmid 27082), pCAGMKOSiE (11,395 bp; Addgene plasmid 20865), pEP4 EO2S EM2K (16,680 bp; Addgene plasmid 20923), pEphrin-B2/IRES-eGFP (6,408 bp) was kindly provided by Pr. ..

Article Title: Efficient Generation of Virus-Free iPS Cells Using Liposomal Magnetofection
Article Snippet: STO cells (a mouse embryonic fibroblast cell line) were purchased from the American Type Culture Collection (ATCC, USA) and cultured in DMEM supplemented with 10% defined FBS, 0.1 mM nonessential amino acids (NEAA), 0.1 mM sodium pyruvate, 100 mM β-mercaptoethanol (Gibco), and 1% penicillin/streptomycin (Gibco). .. The pCX-OKS-2A (OKS, plasmid vector expressing Oct4, Klf4, and Sox2) and pCX–cMyc (C, plasmid vector expressing cMyc) were purchased from Addgene. ..

Transformation Assay:

Article Title: Effects of bacteria‑mediated reprogramming and antibiotic pretreatment on the course of colitis in mice.
Article Snippet: .. The bacterial strain Salmonella typhimurium SL7207, which is suitable for bactofection of eukaryotic cells, was transformed with eukaryotic expression plasmids pcDNA3‐RFP (Addgene, Cambridge, MA, USA) (8), carrying the gene encoding red fluorescent protein (RFP), or pCX‐OKS‐2A (Addgene), carrying genes encoding the reprogramming factors Oct3/4, Klf4 and Sox2 (OKS). ..

Expressing:

Retroviral:

Article Title: Derivation of Induced Trophoblast Cell Lines in Cattle by Doxycycline-Inducible piggyBac Vectors
Article Snippet: .. The original vectors including PB-TET-MKOS (a tetracycline inducible polycistronic vector containing transcription factors in the following order: c-Myc , Klf4 , Oct3/4 , and Sox2 ), PB-CAG-rtTA Adv and pCX-OKS-2A (a polycistronic retroviral vector containing transcription factors in the following order: Oct3/4 , Klf4 , and Sox2 ) were obtained from Addgene (plasmids 20959, 20910, and 19771, respectively) [ , ]. ..

other:

Article Title: KLF4 N-Terminal Variance Modulates Induced Reprogramming to Pluripotency
Article Snippet: Addgene , Klf4/KLF4 , Shinya Yamanaka , 19771 , pCX-OKS-2A , Oct3/4-2A-Klf4-2A-Sox2 , M. musculus , poly , ● , , n/c , ○ , ○ , 18845712 , .

Image Search Results

List of the specific sequences of Oct4, Klf4 and Sox2.

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: List of the specific sequences of Oct4, Klf4 and Sox2.

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques:

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: List of primers.

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques:

(Up) SDS-PAGE analysis displayed that fusion recombinant proteins of PTD-Oct4/Klf4/Sox2 were loaded onto a Ni affinity column and eluted with 60 mmol/L imidazole (indicated by large arrows). Small arrows revealed the identification of purified reprogramming proteins of PTD-Oct4 (35 kDa), PTD-Klf4 (66.2 bp) and PTD-Sox2 (35.8 kDa) by SDS-PAGE and western blotting (WB). (Down) There were significant FRET signals on 565 nm (PTD-Oct4), 570 nm (PTD-Klf4) and PTD-Sox2 (570 nm) (down A, indicated by arrow heads), while no FRET signal between reprogramming proteins and non-target sequence (down B).

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: (Up) SDS-PAGE analysis displayed that fusion recombinant proteins of PTD-Oct4/Klf4/Sox2 were loaded onto a Ni affinity column and eluted with 60 mmol/L imidazole (indicated by large arrows). Small arrows revealed the identification of purified reprogramming proteins of PTD-Oct4 (35 kDa), PTD-Klf4 (66.2 bp) and PTD-Sox2 (35.8 kDa) by SDS-PAGE and western blotting (WB). (Down) There were significant FRET signals on 565 nm (PTD-Oct4), 570 nm (PTD-Klf4) and PTD-Sox2 (570 nm) (down A, indicated by arrow heads), while no FRET signal between reprogramming proteins and non-target sequence (down B).

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques: SDS Page, Recombinant, Affinity Column, Purification, Western Blot, Sequencing

The nuclei of ADSCs (about 50% ∼60%) showed detectable fluorescence from specific antibodies of Oct4, Klf4 and Sox2 after ADSCs were transduced with reprogramming proteins (PTD-Oct4, PTD-Klf4 and PTD-Sox2) respectively for 4 h and then cultivated in conventional medium for 20 h. No fluorescent cells were observed when ADSCs were incubated with PBS in control. Scale bars represent 50 µm and DAPI for nuclear staining.

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: The nuclei of ADSCs (about 50% ∼60%) showed detectable fluorescence from specific antibodies of Oct4, Klf4 and Sox2 after ADSCs were transduced with reprogramming proteins (PTD-Oct4, PTD-Klf4 and PTD-Sox2) respectively for 4 h and then cultivated in conventional medium for 20 h. No fluorescent cells were observed when ADSCs were incubated with PBS in control. Scale bars represent 50 µm and DAPI for nuclear staining.

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques: Fluorescence, Transduction, Incubation, Staining

(A) ADSCs formed big and dense aggregations in group E after microgravity culture on day 5. (B) These ADSCs spheroids readily attached to the surface of plates after they were re-plated onto the adherent culture plates on day 5. (C) The spheroids generated cells that eventually repopulated as a confluent monolayer on day 7. These adherent ADSCs spheroids in group E positively expressed Nanog (D), while negatively expressed Oct4 (E), Sox2 (F) and Klf4 (G) by immunofluorescence staining on day 9. ADSCs spheroids in group D (H) and cells in control group (I) did not express Nanog by immunofluorescence staining. Scale bars represent 100 µm and DAPI for nuclear staining (D–I).

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: (A) ADSCs formed big and dense aggregations in group E after microgravity culture on day 5. (B) These ADSCs spheroids readily attached to the surface of plates after they were re-plated onto the adherent culture plates on day 5. (C) The spheroids generated cells that eventually repopulated as a confluent monolayer on day 7. These adherent ADSCs spheroids in group E positively expressed Nanog (D), while negatively expressed Oct4 (E), Sox2 (F) and Klf4 (G) by immunofluorescence staining on day 9. ADSCs spheroids in group D (H) and cells in control group (I) did not express Nanog by immunofluorescence staining. Scale bars represent 100 µm and DAPI for nuclear staining (D–I).

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques: Generated, Immunofluorescence, Staining

The gene expressions of Nanog of human ADSCs spheroids after 7 cycle treatment of PTD-OKS and purmorphamine in group D and after microgravity culture in group E was positively displayed. However, ADSCs in control group did not express Nanog gene. The undifferentiated gene expressions of Oct4, Sox2, Klf4 were negative in all ADSCs and GAPDH were expressed in all ADSCs.

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: The gene expressions of Nanog of human ADSCs spheroids after 7 cycle treatment of PTD-OKS and purmorphamine in group D and after microgravity culture in group E was positively displayed. However, ADSCs in control group did not express Nanog gene. The undifferentiated gene expressions of Oct4, Sox2, Klf4 were negative in all ADSCs and GAPDH were expressed in all ADSCs.

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques:

(A) Human ADSCs on decellularized corneas after sequential non-genetic direct reprogramming with co-culture treatments of both of R-CECs and R-CSCs were obviously positive staining for vimentin and weakly expressed CD31, AQP-1 and ZO-1. (B) ADSCs on decellularized corneas after sequential non-genetic direct reprogramming without co-culture treatments were positive staining for vimentin but negative for CD31, AQP-1 and ZO-1. (C) The undifferentiated gene transcripts of Oct4, Sox2, Klf4 and Nanog could not be detected in ADSCs on decellularized corneas after sequential non-genetic direct reprogramming with (a) or without (b) co-culture treatments. Scale bars represent 100 µm and DAPI for nuclear staining (A, B).

Journal: PLoS ONE

Article Title: Non-Genetic Direct Reprogramming and Biomimetic Platforms in a Preliminary Study for Adipose-Derived Stem Cells into Corneal Endothelia-Like Cells

doi: 10.1371/journal.pone.0109856

Figure Lengend Snippet: (A) Human ADSCs on decellularized corneas after sequential non-genetic direct reprogramming with co-culture treatments of both of R-CECs and R-CSCs were obviously positive staining for vimentin and weakly expressed CD31, AQP-1 and ZO-1. (B) ADSCs on decellularized corneas after sequential non-genetic direct reprogramming without co-culture treatments were positive staining for vimentin but negative for CD31, AQP-1 and ZO-1. (C) The undifferentiated gene transcripts of Oct4, Sox2, Klf4 and Nanog could not be detected in ADSCs on decellularized corneas after sequential non-genetic direct reprogramming with (a) or without (b) co-culture treatments. Scale bars represent 100 µm and DAPI for nuclear staining (A, B).

Article Snippet: The plasmids containing the Oct4, Klf4 and Sox2 gene strains pCX-OKS-2A were obtained from Addgene ( http://www.addgene.org ).

Techniques: Co-Culture Assay, Staining

(A) Alkaline phosphatase (AP) staining. Seven LMF-iPS cell lines examined expressed high levels of AP, similar to D3 ES cells. (B) Immunofluorescence staining of the ES cell-specific markers Oct4 and stage-specific embryonic antigen 1 (SSEA1). Scale bars: 200 µm. (C) mRNA expression of ES cell-specific markers (Nanog, Tert, Zfp, Oct4, and Sox2) and exogenous genes (Kl4 and c-Myc). G3PDH was used as a loading control.

Journal: PLoS ONE

Article Title: Efficient Generation of Virus-Free iPS Cells Using Liposomal Magnetofection

doi: 10.1371/journal.pone.0045812

Figure Lengend Snippet: (A) Alkaline phosphatase (AP) staining. Seven LMF-iPS cell lines examined expressed high levels of AP, similar to D3 ES cells. (B) Immunofluorescence staining of the ES cell-specific markers Oct4 and stage-specific embryonic antigen 1 (SSEA1). Scale bars: 200 µm. (C) mRNA expression of ES cell-specific markers (Nanog, Tert, Zfp, Oct4, and Sox2) and exogenous genes (Kl4 and c-Myc). G3PDH was used as a loading control.

Article Snippet: The pCX-OKS-2A (OKS, plasmid vector expressing Oct4, Klf4, and Sox2) and pCX–cMyc (C, plasmid vector expressing cMyc) were purchased from Addgene.

Techniques: Staining, Immunofluorescence, Expressing

(A) Southern blot analysis of D3 ES cells, seven LMF-iPS cell lines, and MEF cells using probes against Oct4, Sox2, Klf4, and c-Myc. Genomic DNA (15 µg) was digested with EcoRI. The arrows indicate bands derived from the transgenes. Closed and open arrowheads indicate bands derived from endogenous genes or nonspecific bands integrated into the genomic DNA, respectively. (B) Detection of plasmid integration by PCR. Genomic DNA (100 ng) from D3 ES cells, LMF-iPS cells, and MEFs was amplified by PCR using plasmid-specific primers (amplified regions: O, Oct4; S, Sox2; K, Klf4; C, cMyc; pA, polyadenylation signal and backbone; Amp, ampicillin resistant gene; and CAG, CAG promoter). In the K and C PCR results, closed arrowheads indicate bands derived from endogenous genes and open arrowheads indicate integrated exogenous genes.

Journal: PLoS ONE

Article Title: Efficient Generation of Virus-Free iPS Cells Using Liposomal Magnetofection

doi: 10.1371/journal.pone.0045812

Figure Lengend Snippet: (A) Southern blot analysis of D3 ES cells, seven LMF-iPS cell lines, and MEF cells using probes against Oct4, Sox2, Klf4, and c-Myc. Genomic DNA (15 µg) was digested with EcoRI. The arrows indicate bands derived from the transgenes. Closed and open arrowheads indicate bands derived from endogenous genes or nonspecific bands integrated into the genomic DNA, respectively. (B) Detection of plasmid integration by PCR. Genomic DNA (100 ng) from D3 ES cells, LMF-iPS cells, and MEFs was amplified by PCR using plasmid-specific primers (amplified regions: O, Oct4; S, Sox2; K, Klf4; C, cMyc; pA, polyadenylation signal and backbone; Amp, ampicillin resistant gene; and CAG, CAG promoter). In the K and C PCR results, closed arrowheads indicate bands derived from endogenous genes and open arrowheads indicate integrated exogenous genes.

Article Snippet: The pCX-OKS-2A (OKS, plasmid vector expressing Oct4, Klf4, and Sox2) and pCX–cMyc (C, plasmid vector expressing cMyc) were purchased from Addgene.

Techniques: Southern Blot, Derivative Assay, Plasmid Preparation, Amplification

(A) Phase-contrast images of the two LMF-iPS cell lines, according to spontaneous differentiation for 20 days. (B) RT-PCR analysis of the spontaneous differentiation of the two LMF-iPS cell lines into three germ-like layers expressing undifferentiated ES cell markers (Oct4 and Nanog), as well as endodermal (α-fetoprotein and α-amylase), mesodermal (β-enolase and renin), and ectodermal (Map2 and β-tubulin) genes. (C) Immunocytochemistry of neuronal cell differentiation in the two LMF-iPS cell lines into Map2-, Tuj1-, and GFAP-positive cells. (D and E) RT-PCR and immunostaining results showing cardiac (TnI) and endothelial (Tie2) cell differentiation of two LMF-iPS cell lines. Blue nuclear staining is by DAPI.

Journal: PLoS ONE

Article Title: Efficient Generation of Virus-Free iPS Cells Using Liposomal Magnetofection

doi: 10.1371/journal.pone.0045812

Figure Lengend Snippet: (A) Phase-contrast images of the two LMF-iPS cell lines, according to spontaneous differentiation for 20 days. (B) RT-PCR analysis of the spontaneous differentiation of the two LMF-iPS cell lines into three germ-like layers expressing undifferentiated ES cell markers (Oct4 and Nanog), as well as endodermal (α-fetoprotein and α-amylase), mesodermal (β-enolase and renin), and ectodermal (Map2 and β-tubulin) genes. (C) Immunocytochemistry of neuronal cell differentiation in the two LMF-iPS cell lines into Map2-, Tuj1-, and GFAP-positive cells. (D and E) RT-PCR and immunostaining results showing cardiac (TnI) and endothelial (Tie2) cell differentiation of two LMF-iPS cell lines. Blue nuclear staining is by DAPI.

Article Snippet: The pCX-OKS-2A (OKS, plasmid vector expressing Oct4, Klf4, and Sox2) and pCX–cMyc (C, plasmid vector expressing cMyc) were purchased from Addgene.

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Immunocytochemistry, Cell Differentiation, Immunostaining, Staining

Balb/C mice were HTV injected with 0.9% saline alone, 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline and at days 2, 4, 8, 12, 24, RT-qPCR analysis of hepatocytes was performed to determine the relative gene expression of: ( a ) transfected transcription factors (OKSM) and ( b ) endogenous pluripotency markers. All gene expression levels were normalized to HTV-injected saline group (*p<0.05 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison); ( c ) flow cytometry analysis of OCT3/4 positive and NANOG positive cells in liver extracts; ( d ) relative gene expression of hepatocyte markers as determined by RT-qPCR. All gene expression levels were normalized to saline HTV-injected group (* p<0.05 indicates statistically significant differences between the expression levels for hepatocyte markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison).

Journal: PLoS ONE

Article Title: In Vivo Cell Reprogramming towards Pluripotency by Virus-Free Overexpression of Defined Factors

doi: 10.1371/journal.pone.0054754

Figure Lengend Snippet: Balb/C mice were HTV injected with 0.9% saline alone, 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline and at days 2, 4, 8, 12, 24, RT-qPCR analysis of hepatocytes was performed to determine the relative gene expression of: ( a ) transfected transcription factors (OKSM) and ( b ) endogenous pluripotency markers. All gene expression levels were normalized to HTV-injected saline group (*p<0.05 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison); ( c ) flow cytometry analysis of OCT3/4 positive and NANOG positive cells in liver extracts; ( d ) relative gene expression of hepatocyte markers as determined by RT-qPCR. All gene expression levels were normalized to saline HTV-injected group (* p<0.05 indicates statistically significant differences between the expression levels for hepatocyte markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison).

Article Snippet: Reprogramming plasmids pCX-OKS-2A encoding OCT3/4, KLF4, SOX2 ; pCX-cMyc encoding CMYC and pCAG-GFP encoding eGFP under the control of CAG promoter (as previously described by Okita et al. ) were obtained from Addgene (USA) as bacterial stabs.

Techniques: Injection, Quantitative RT-PCR, Expressing, Transfection, Flow Cytometry

Balb/C mice HTV injected with 0.9% saline alone, pCX-OKS-2A with (OSKM) and without (OKS) pCX-cMyc in 0.9% saline, or pCAG-GFP in 0.9% saline, at the indicated doses. On day 4, RT-qPCR analysis of hepatocyte extracts was performed. ( a ) Expression levels of the injected reprogramming transcription factors and endogenous pluripotency genes were determined for plasmid dose-escalation (total plasmid dose 50, 75 and 100 µg/animal). All gene expression levels were normalized to the HTV-injected saline group (*p<0.05 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison); ( b ) Expression levels of the injected reprogramming transcription factors and endogenous pluripotency genes with and without inclusion of cMyc . All gene expression levels were normalized to HTV-injected saline group (**p<0.01 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and OKS injected groups, obtained by the analysis of variance and Tukey's pairwise comparison).

Journal: PLoS ONE

Article Title: In Vivo Cell Reprogramming towards Pluripotency by Virus-Free Overexpression of Defined Factors

doi: 10.1371/journal.pone.0054754

Figure Lengend Snippet: Balb/C mice HTV injected with 0.9% saline alone, pCX-OKS-2A with (OSKM) and without (OKS) pCX-cMyc in 0.9% saline, or pCAG-GFP in 0.9% saline, at the indicated doses. On day 4, RT-qPCR analysis of hepatocyte extracts was performed. ( a ) Expression levels of the injected reprogramming transcription factors and endogenous pluripotency genes were determined for plasmid dose-escalation (total plasmid dose 50, 75 and 100 µg/animal). All gene expression levels were normalized to the HTV-injected saline group (*p<0.05 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison); ( b ) Expression levels of the injected reprogramming transcription factors and endogenous pluripotency genes with and without inclusion of cMyc . All gene expression levels were normalized to HTV-injected saline group (**p<0.01 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and OKS injected groups, obtained by the analysis of variance and Tukey's pairwise comparison).

Techniques: Injection, Quantitative RT-PCR, Expressing, Plasmid Preparation

Balb/C mice HTV injected with 0.9% saline alone, 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline, or 150 µg of pCAG-GFP in 0.9% saline and at day 4, livers were collected and frozen tissue sections were stained with anti-OCT4, anti-SOX2 or anti-NANOG antibodies to assess immunoreactivity, or BCIP/NBT to determine ALP activity in the tissue (40x). Scale bars represent 100 µm.

Journal: PLoS ONE

Article Title: In Vivo Cell Reprogramming towards Pluripotency by Virus-Free Overexpression of Defined Factors

doi: 10.1371/journal.pone.0054754

Figure Lengend Snippet: Balb/C mice HTV injected with 0.9% saline alone, 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline, or 150 µg of pCAG-GFP in 0.9% saline and at day 4, livers were collected and frozen tissue sections were stained with anti-OCT4, anti-SOX2 or anti-NANOG antibodies to assess immunoreactivity, or BCIP/NBT to determine ALP activity in the tissue (40x). Scale bars represent 100 µm.

Techniques: Injection, Staining, Activity Assay

TNG-A mice were HTV injected with 0.9% saline alone, 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline and at days 2, 4, RT-qPCR analysis of hepatocytes was performed to determine the relative gene expression of: ( a ) transfected transcription factors (OKSM) and ( b ) endogenous pluripotency markers. All gene expression levels were normalized to HTV-injected saline group (*p<0.05 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison); ( c ) flow cytometry analysis of GFP positive cells in liver extracts; ( d ) liver tissue frozen and sectioned to image GFP-positive cells with fluorescence microscopy at day 4 (10x).

Journal: PLoS ONE

Article Title: In Vivo Cell Reprogramming towards Pluripotency by Virus-Free Overexpression of Defined Factors

doi: 10.1371/journal.pone.0054754

Figure Lengend Snippet: TNG-A mice were HTV injected with 0.9% saline alone, 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline and at days 2, 4, RT-qPCR analysis of hepatocytes was performed to determine the relative gene expression of: ( a ) transfected transcription factors (OKSM) and ( b ) endogenous pluripotency markers. All gene expression levels were normalized to HTV-injected saline group (*p<0.05 indicates statistically significant differences between the expression levels of pluripotency markers in the OKSM and saline HTV-injected groups, obtained by the analysis of variance and Tukey's pairwise comparison); ( c ) flow cytometry analysis of GFP positive cells in liver extracts; ( d ) liver tissue frozen and sectioned to image GFP-positive cells with fluorescence microscopy at day 4 (10x).

Techniques: Injection, Quantitative RT-PCR, Expressing, Transfection, Flow Cytometry, Fluorescence, Microscopy

Balb/C mice HTV injected with either 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline or 0.9% saline only. On days 2, 4, 8, 12, 50 and 120 livers and sera were isolated. ( a ) H&E staining of liver sections; ( b ) levels of liver enzymes and ( c ) albumin were analyzed; ( d ) liver sections were PAS stained to determine glycogen storage levels. Representative images were captured with light microscopy (10x). Scale bars represent 100 µm.

Journal: PLoS ONE

Article Title: In Vivo Cell Reprogramming towards Pluripotency by Virus-Free Overexpression of Defined Factors

doi: 10.1371/journal.pone.0054754

Figure Lengend Snippet: Balb/C mice HTV injected with either 75 µg of pCX-OKS-2A and 75 µg pCX-cMyc in 0.9% saline or 0.9% saline only. On days 2, 4, 8, 12, 50 and 120 livers and sera were isolated. ( a ) H&E staining of liver sections; ( b ) levels of liver enzymes and ( c ) albumin were analyzed; ( d ) liver sections were PAS stained to determine glycogen storage levels. Representative images were captured with light microscopy (10x). Scale bars represent 100 µm.

Techniques: Injection, Isolation, Staining, Light Microscopy

Review

pb tac oks (Addgene inc)

Structured Review

Images

Related Articles

Transfection:

Sequencing:

Plasmid Preparation:

Transformation Assay:

Expressing:

Retroviral:

other:

Similar Products

Image Search Results